mmessage mmachine sp6 transcription kit (Thermo Fisher)
Thermo Fisher is a verified supplier 
Thermo Fisher manufactures this product 
90
Structured Review
Thermo Fisher
mmessage mmachine sp6 transcription kit
Mmessage Mmachine Sp6 Transcription Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mmessage+mmachine+sp6+transcription+kit/mmessage+mmachine+sp6+transcription+kit/pm40629111-253-40-45
Average 90 stars, based on 1 article reviews
Mmessage Mmachine Sp6 Transcription Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mmessage+mmachine+sp6+transcription+kit/mmessage+mmachine+sp6+transcription+kit/pm40629111-253-40-45
Average 90 stars, based on 1 article reviews
mmessage mmachine sp6 transcription kit - by Bioz Stars,
2026-10
90/100 stars
Images
Related Articles
Synthesized:Article Title: Supporting Information (SI) Appendix for Mosaicism-independent mechanisms contribute to Pcdh19-related epilepsy and repetitive behaviors in Xenopus Article Snippet: .. Capped RNAs encoding EGFP were synthesized by using Article Title: A CRISPR/Cas9-induced point mutation on the GABA receptor subunit RDL confers high resistance to phenylpyrazole insecticides in the rice planthopper Laodelphax striatellus. Article Snippet: The Delphacidae planthopper Laodelphax striatellus (Order: Hemiptera) is one of the most damaging insect pests of rice crops in Asia.. The phenylpyrazole insecticide fipronil was introduced in China in the mid-1990s to control these pests, but its widespread use has led to the development of high levels of resistance.. Field sampling coupled with in vitro assays indicated that an A2′N-point mutation in the gamma-aminobutyric acid receptor RDL has been linked to fipronil resistance; however, genetic evidence supporting this association has been lacking. Article Title: The human ciliopathy protein RSG1 links the CPLANE complex to transition zone architecture. Article Snippet: To generate a Xenopus allele corresponding to the human patient allele, mutagenesis was performed on the GFP and FLAG-tagged Xenopus Rsg1, using Q5 Site-Directed Mutagenesis Kit (NEB, Cat # E0554S). .. Capped mRNAs were synthesized using the Article Title: The human ciliopathy protein RSG1 links the CPLANE complex to transition zone architecture Article Snippet: To generate a Xenopus allele corresponding to the human patient allele, mutagenesis was performed on the GFP and FLAG-tagged Xenopus Rsg1, using Q5 Site-Directed Mutagenesis Kit (NEB, Cat # E0554S). .. Capped mRNAs were synthesized using the Article Title: Prickle2 regulates apical junction remodeling and tissue fluidity during vertebrate neurulation. Article Snippet: .. Capped RNA was synthesized via In Vitro:Article Title: A CRISPR/Cas9-induced point mutation on the GABA receptor subunit RDL confers high resistance to phenylpyrazole insecticides in the rice planthopper Laodelphax striatellus. Article Snippet: The Delphacidae planthopper Laodelphax striatellus (Order: Hemiptera) is one of the most damaging insect pests of rice crops in Asia.. The phenylpyrazole insecticide fipronil was introduced in China in the mid-1990s to control these pests, but its widespread use has led to the development of high levels of resistance.. Field sampling coupled with in vitro assays indicated that an A2′N-point mutation in the gamma-aminobutyric acid receptor RDL has been linked to fipronil resistance; however, genetic evidence supporting this association has been lacking. Article Title: Amino acid changes in two viral proteins drive attenuation of the yellow fever 17D vaccine. Article Snippet: .. Generation of YFV or reporter YFV by in vitro RNA transcription Midi-prepped (QIAGEN) plasmids of YFV infectious clones or mScarlet reporter YFVs were linearized with AflII (17D and Asibi; NEB) or SnaBI (Dakar; NEB) and in vitro transcribed using the Plasmid Preparation:Article Title: A CRISPR/Cas9-induced point mutation on the GABA receptor subunit RDL confers high resistance to phenylpyrazole insecticides in the rice planthopper Laodelphax striatellus. Article Snippet: The Delphacidae planthopper Laodelphax striatellus (Order: Hemiptera) is one of the most damaging insect pests of rice crops in Asia.. The phenylpyrazole insecticide fipronil was introduced in China in the mid-1990s to control these pests, but its widespread use has led to the development of high levels of resistance.. Field sampling coupled with in vitro assays indicated that an A2′N-point mutation in the gamma-aminobutyric acid receptor RDL has been linked to fipronil resistance; however, genetic evidence supporting this association has been lacking. Article Title: A genetic modifier links integrin α5 to the phenotypic variation in fibronectin 1a mutant zebrafish. Article Snippet: The following primer sequences were used to amplify target genes: fn1a RT-qPCR F1 – 5’-GTGCAGTGTATG CCGAAAG-3’, fn1a RT-qPCR R1 – 5’-TGTCCGTCCATAACACATCC-3’; fn1a RT-qPCR F2 – 5’-CCACCCACTGATCT GAACCT-3’, fn1a RT-qPCR R2 – 5’-TCACTCTGTAGCCCGTGATG-3’; fn1a RT-qPCR F3 – 5’-AGAACCTTCGC GTCCATC-3’, fn1a RT-qPCR R3 – 5’-AGGGGGAAGCTGCTCAAT-3’; fn1b RT-qPCR F – 5’-CAGGGGTCAAGTG TAGATCC-3’, fn1b RT-qPCR R – 5’-TATCCTTTGGTCGCTCGTAG-3’; itgα5 F – 5’-ACGGCAGAGCTCATTGAA-3’, itgα5 R – 5’-AGTTTCAGGTCAGGGACG-3’; rpl13a RT-qPCR F – 5’-TGGAGGACTGTAAGAGGTATGC-3’, rpl13a RT-qPCR R – 5’-ACGCACAATCTTGAGAGCAG-3’. rpl13a primers are described in [76], and fn1a primer pair 2 in [77]. mRNA overexpression fn1a and fn1b sequences from WT cDNA obtained from mixed staged AB embryos were cloned into the pCS2 + expression vector using NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs, cat. no. E2621S). .. The itgα5 coding sequence was previously cloned into the pCS2 + plasmid [51]. mRNA was transcribed from NotI linearised plasmid templates using the Article Title: ZNF574 is a quality control factor for defective ribosome biogenesis intermediates. Article Snippet: Progeny of wild type AB lines were microinjected at the 1-cell stage with 0.025 ng wild type or mutant uL16 mRNA and/or 0.5 pmol znf574 morpholino oligonucleotides (Gene Tool, Table S6). uL16 mRNA was produced by using PCR to amplify the region of interest from the corresponding plasmid (Table S6) with Forward (ATTTAGGTGACACTATAGAAGGTGCTGGTTGTTGTGCTGTCTCAT) and reverse (TGATCTAGAGGATCATAATCAGCCATACCA) primers, and using mMESSAGE mMACHINE SP6 Transcription kit (AM1340, Thermo Fisher Scientific) followed by phenol/chloroform-isoamyl extraction. .. Progeny of wild type AB lines were microinjected at the 1-cell stage with 0.025 ng wild type or mutant uL16 mRNA and/or 0.5 pmol znf574 morpholino oligonucleotides (Gene Tool, Table S6). uL16 mRNA was produced by using PCR to amplify the region of interest from the corresponding plasmid (Table S6) with Forward (ATTTAGGTGACACTATAGAAGGTGCTGGTTGTTGTGCTGTCTCAT) and reverse (TGATCTAGAGGATCATAATCAGCCATACCA) primers, and using Sequencing:Article Title: A genetic modifier links integrin α5 to the phenotypic variation in fibronectin 1a mutant zebrafish. Article Snippet: The following primer sequences were used to amplify target genes: fn1a RT-qPCR F1 – 5’-GTGCAGTGTATG CCGAAAG-3’, fn1a RT-qPCR R1 – 5’-TGTCCGTCCATAACACATCC-3’; fn1a RT-qPCR F2 – 5’-CCACCCACTGATCT GAACCT-3’, fn1a RT-qPCR R2 – 5’-TCACTCTGTAGCCCGTGATG-3’; fn1a RT-qPCR F3 – 5’-AGAACCTTCGC GTCCATC-3’, fn1a RT-qPCR R3 – 5’-AGGGGGAAGCTGCTCAAT-3’; fn1b RT-qPCR F – 5’-CAGGGGTCAAGTG TAGATCC-3’, fn1b RT-qPCR R – 5’-TATCCTTTGGTCGCTCGTAG-3’; itgα5 F – 5’-ACGGCAGAGCTCATTGAA-3’, itgα5 R – 5’-AGTTTCAGGTCAGGGACG-3’; rpl13a RT-qPCR F – 5’-TGGAGGACTGTAAGAGGTATGC-3’, rpl13a RT-qPCR R – 5’-ACGCACAATCTTGAGAGCAG-3’. rpl13a primers are described in [76], and fn1a primer pair 2 in [77]. mRNA overexpression fn1a and fn1b sequences from WT cDNA obtained from mixed staged AB embryos were cloned into the pCS2 + expression vector using NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs, cat. no. E2621S). .. The itgα5 coding sequence was previously cloned into the pCS2 + plasmid [51]. mRNA was transcribed from NotI linearised plasmid templates using the Clone Assay:Article Title: A genetic modifier links integrin α5 to the phenotypic variation in fibronectin 1a mutant zebrafish. Article Snippet: The following primer sequences were used to amplify target genes: fn1a RT-qPCR F1 – 5’-GTGCAGTGTATG CCGAAAG-3’, fn1a RT-qPCR R1 – 5’-TGTCCGTCCATAACACATCC-3’; fn1a RT-qPCR F2 – 5’-CCACCCACTGATCT GAACCT-3’, fn1a RT-qPCR R2 – 5’-TCACTCTGTAGCCCGTGATG-3’; fn1a RT-qPCR F3 – 5’-AGAACCTTCGC GTCCATC-3’, fn1a RT-qPCR R3 – 5’-AGGGGGAAGCTGCTCAAT-3’; fn1b RT-qPCR F – 5’-CAGGGGTCAAGTG TAGATCC-3’, fn1b RT-qPCR R – 5’-TATCCTTTGGTCGCTCGTAG-3’; itgα5 F – 5’-ACGGCAGAGCTCATTGAA-3’, itgα5 R – 5’-AGTTTCAGGTCAGGGACG-3’; rpl13a RT-qPCR F – 5’-TGGAGGACTGTAAGAGGTATGC-3’, rpl13a RT-qPCR R – 5’-ACGCACAATCTTGAGAGCAG-3’. rpl13a primers are described in [76], and fn1a primer pair 2 in [77]. mRNA overexpression fn1a and fn1b sequences from WT cDNA obtained from mixed staged AB embryos were cloned into the pCS2 + expression vector using NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs, cat. no. E2621S). .. The itgα5 coding sequence was previously cloned into the pCS2 + plasmid [51]. mRNA was transcribed from NotI linearised plasmid templates using the Article Title: Amino acid changes in two viral proteins drive attenuation of the yellow fever 17D vaccine. Article Snippet: .. Generation of YFV or reporter YFV by in vitro RNA transcription Midi-prepped (QIAGEN) plasmids of YFV infectious clones or mScarlet reporter YFVs were linearized with AflII (17D and Asibi; NEB) or SnaBI (Dakar; NEB) and in vitro transcribed using the Purification:Article Title: A genetic modifier links integrin α5 to the phenotypic variation in fibronectin 1a mutant zebrafish. Article Snippet: The following primer sequences were used to amplify target genes: fn1a RT-qPCR F1 – 5’-GTGCAGTGTATG CCGAAAG-3’, fn1a RT-qPCR R1 – 5’-TGTCCGTCCATAACACATCC-3’; fn1a RT-qPCR F2 – 5’-CCACCCACTGATCT GAACCT-3’, fn1a RT-qPCR R2 – 5’-TCACTCTGTAGCCCGTGATG-3’; fn1a RT-qPCR F3 – 5’-AGAACCTTCGC GTCCATC-3’, fn1a RT-qPCR R3 – 5’-AGGGGGAAGCTGCTCAAT-3’; fn1b RT-qPCR F – 5’-CAGGGGTCAAGTG TAGATCC-3’, fn1b RT-qPCR R – 5’-TATCCTTTGGTCGCTCGTAG-3’; itgα5 F – 5’-ACGGCAGAGCTCATTGAA-3’, itgα5 R – 5’-AGTTTCAGGTCAGGGACG-3’; rpl13a RT-qPCR F – 5’-TGGAGGACTGTAAGAGGTATGC-3’, rpl13a RT-qPCR R – 5’-ACGCACAATCTTGAGAGCAG-3’. rpl13a primers are described in [76], and fn1a primer pair 2 in [77]. mRNA overexpression fn1a and fn1b sequences from WT cDNA obtained from mixed staged AB embryos were cloned into the pCS2 + expression vector using NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs, cat. no. E2621S). .. The itgα5 coding sequence was previously cloned into the pCS2 + plasmid [51]. mRNA was transcribed from NotI linearised plasmid templates using the Article Title: Prickle2 regulates apical junction remodeling and tissue fluidity during vertebrate neurulation. Article Snippet: .. Capped RNA was synthesized via Mutagenesis:Article Title: ZNF574 is a quality control factor for defective ribosome biogenesis intermediates. Article Snippet: Progeny of wild type AB lines were microinjected at the 1-cell stage with 0.025 ng wild type or mutant uL16 mRNA and/or 0.5 pmol znf574 morpholino oligonucleotides (Gene Tool, Table S6). uL16 mRNA was produced by using PCR to amplify the region of interest from the corresponding plasmid (Table S6) with Forward (ATTTAGGTGACACTATAGAAGGTGCTGGTTGTTGTGCTGTCTCAT) and reverse (TGATCTAGAGGATCATAATCAGCCATACCA) primers, and using mMESSAGE mMACHINE SP6 Transcription kit (AM1340, Thermo Fisher Scientific) followed by phenol/chloroform-isoamyl extraction. .. Progeny of wild type AB lines were microinjected at the 1-cell stage with 0.025 ng wild type or mutant uL16 mRNA and/or 0.5 pmol znf574 morpholino oligonucleotides (Gene Tool, Table S6). uL16 mRNA was produced by using PCR to amplify the region of interest from the corresponding plasmid (Table S6) with Forward (ATTTAGGTGACACTATAGAAGGTGCTGGTTGTTGTGCTGTCTCAT) and reverse (TGATCTAGAGGATCATAATCAGCCATACCA) primers, and using Produced:Article Title: ZNF574 is a quality control factor for defective ribosome biogenesis intermediates. Article Snippet: Progeny of wild type AB lines were microinjected at the 1-cell stage with 0.025 ng wild type or mutant uL16 mRNA and/or 0.5 pmol znf574 morpholino oligonucleotides (Gene Tool, Table S6). uL16 mRNA was produced by using PCR to amplify the region of interest from the corresponding plasmid (Table S6) with Forward (ATTTAGGTGACACTATAGAAGGTGCTGGTTGTTGTGCTGTCTCAT) and reverse (TGATCTAGAGGATCATAATCAGCCATACCA) primers, and using mMESSAGE mMACHINE SP6 Transcription kit (AM1340, Thermo Fisher Scientific) followed by phenol/chloroform-isoamyl extraction. .. Progeny of wild type AB lines were microinjected at the 1-cell stage with 0.025 ng wild type or mutant uL16 mRNA and/or 0.5 pmol znf574 morpholino oligonucleotides (Gene Tool, Table S6). uL16 mRNA was produced by using PCR to amplify the region of interest from the corresponding plasmid (Table S6) with Forward (ATTTAGGTGACACTATAGAAGGTGCTGGTTGTTGTGCTGTCTCAT) and reverse (TGATCTAGAGGATCATAATCAGCCATACCA) primers, and using Polymerase Chain Reaction:Article Title: ZNF574 is a quality control factor for defective ribosome biogenesis intermediates. Article Snippet: Progeny of wild type AB lines were microinjected at the 1-cell stage with 0.025 ng wild type or mutant uL16 mRNA and/or 0.5 pmol znf574 morpholino oligonucleotides (Gene Tool, Table S6). uL16 mRNA was produced by using PCR to amplify the region of interest from the corresponding plasmid (Table S6) with Forward (ATTTAGGTGACACTATAGAAGGTGCTGGTTGTTGTGCTGTCTCAT) and reverse (TGATCTAGAGGATCATAATCAGCCATACCA) primers, and using mMESSAGE mMACHINE SP6 Transcription kit (AM1340, Thermo Fisher Scientific) followed by phenol/chloroform-isoamyl extraction. .. Progeny of wild type AB lines were microinjected at the 1-cell stage with 0.025 ng wild type or mutant uL16 mRNA and/or 0.5 pmol znf574 morpholino oligonucleotides (Gene Tool, Table S6). uL16 mRNA was produced by using PCR to amplify the region of interest from the corresponding plasmid (Table S6) with Forward (ATTTAGGTGACACTATAGAAGGTGCTGGTTGTTGTGCTGTCTCAT) and reverse (TGATCTAGAGGATCATAATCAGCCATACCA) primers, and using Extraction:Article Title: ZNF574 is a quality control factor for defective ribosome biogenesis intermediates. Article Snippet: Progeny of wild type AB lines were microinjected at the 1-cell stage with 0.025 ng wild type or mutant uL16 mRNA and/or 0.5 pmol znf574 morpholino oligonucleotides (Gene Tool, Table S6). uL16 mRNA was produced by using PCR to amplify the region of interest from the corresponding plasmid (Table S6) with Forward (ATTTAGGTGACACTATAGAAGGTGCTGGTTGTTGTGCTGTCTCAT) and reverse (TGATCTAGAGGATCATAATCAGCCATACCA) primers, and using mMESSAGE mMACHINE SP6 Transcription kit (AM1340, Thermo Fisher Scientific) followed by phenol/chloroform-isoamyl extraction. .. Progeny of wild type AB lines were microinjected at the 1-cell stage with 0.025 ng wild type or mutant uL16 mRNA and/or 0.5 pmol znf574 morpholino oligonucleotides (Gene Tool, Table S6). uL16 mRNA was produced by using PCR to amplify the region of interest from the corresponding plasmid (Table S6) with Forward (ATTTAGGTGACACTATAGAAGGTGCTGGTTGTTGTGCTGTCTCAT) and reverse (TGATCTAGAGGATCATAATCAGCCATACCA) primers, and using |